pET-His-Cre
(Plasmid
#123128)
-
PurposeBacterial expression plasmid for wild-type Cre with an N-terminal His-tag.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 123128 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET
- Backbone size w/o insert (bp) 5100
- Total vector size (bp) 6200
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCre recombinase
-
SpeciesP1 coliphage
-
Insert Size (bp)1032
-
GenBank ID2777477
- Promoter T7
-
Tag
/ Fusion Protein
- 6x His tag (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GAAACAAGCGCTCATGAGCCCGAA
- 3′ sequencing primer GTCCCATTCGCCAATCCGGATATAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-His-Cre was a gift from David Liu (Addgene plasmid # 123128 ; http://n2t.net/addgene:123128 ; RRID:Addgene_123128) -
For your References section:
High-resolution specificity profiling and off-target prediction for site-specific DNA recombinases. Jeffrey L. Bessen, Lena K. Afeyan, Vlado Dančík, Luke W. Koblan, David B. Thompson, Chas Leichner, Paul A. Clemons & David R. Liu. Nature Communications volume 10, Article number: 1937 (2019) 10.1038/s41467-019-09987-0