Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pRC10-EFS-huLbCpf1-2A-Blast-WPRE
(Plasmid #123359)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 123359 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFUGW
  • Backbone size w/o insert (bp) 10130
  • Total vector size (bp) 12411
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human codon-optimized Cpf1/Cas12a from Lachnospiraceae bacterium,
  • Alt name
    huLbCpf1
  • Alt name
    huLbCas12a
  • Species
    Synthetic
  • Insert Size (bp)
    3684
  • Promoter EFS-NS

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCCCACAGTCCCCGAGAAGTT
  • 3′ sequencing primer gcaccacgagttctgcacaaggt
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRC10-EFS-huLbCpf1-2A-Blast-WPRE was a gift from Sidi Chen (Addgene plasmid # 123359 ; http://n2t.net/addgene:123359 ; RRID:Addgene_123359)
  • For your References section:

    In vivo profiling of metastatic double knockouts through CRISPR-Cpf1 screens. Chow RD, Wang G, Ye L, Codina A, Kim HR, Shen L, Dong MB, Errami Y, Chen S. Nat Methods. 2019 May;16(5):405-408. doi: 10.1038/s41592-019-0371-5. Epub 2019 Apr 8. 10.1038/s41592-019-0371-5 PubMed 30962622