Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pRC49-U6-DR-crRNA-BsmbI(x2)-6T; EFS-Puro-2A-Fluc-2A-EGFP_NLS-WPRE
(Plasmid #123363)


Item Catalog # Description Quantity Price (USD)
Plasmid 123363 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 9004
  • Total vector size (bp) 9823
  • Modifications to backbone
    Inserted P2A-EGFP_NLS after FLuc
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR, Luciferase
  • Selectable markers
    Puromycin ; EGFP-NLS

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    Nuclear localized EGFP
  • Species
  • Insert Size (bp)
  • Promoter EFS

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gtggacgaagtaccgaaaggtcttacc
  • 3′ sequencing primer cagcgtatccacatagcgtaaaagga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRC49-U6-DR-crRNA-BsmbI(x2)-6T; EFS-Puro-2A-Fluc-2A-EGFP_NLS-WPRE was a gift from Sidi Chen (Addgene plasmid # 123363 ; ; RRID:Addgene_123363)
  • For your References section:

    In vivo profiling of metastatic double knockouts through CRISPR-Cpf1 screens. Chow RD, Wang G, Ye L, Codina A, Kim HR, Shen L, Dong MB, Errami Y, Chen S. Nat Methods. 2019 May;16(5):405-408. doi: 10.1038/s41592-019-0371-5. Epub 2019 Apr 8. 10.1038/s41592-019-0371-5 PubMed 30962622