-
PurposeLentiviral vector with empty U6 cassette containing LbCpf1 direct repeat and U6 terminator, with constitutive expression of puromycin resistance, Firefly luciferase, and nuclear EGFP.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 123363 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRG01
- Backbone size w/o insert (bp) 9004
- Total vector size (bp) 9823
-
Modifications to backboneInserted P2A-EGFP_NLS after FLuc
-
Vector typeMammalian Expression, Lentiviral, CRISPR, Luciferase
-
Selectable markersPuromycin ; EGFP-NLS
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP-NLS
-
Alt nameNuclear localized EGFP
-
SpeciesSynthetic
-
Insert Size (bp)714
- Promoter EFS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtggacgaagtaccgaaaggtcttacc
- 3′ sequencing primer cagcgtatccacatagcgtaaaagga (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRC49-U6-DR-crRNA-BsmbI(x2)-6T; EFS-Puro-2A-Fluc-2A-EGFP_NLS-WPRE was a gift from Sidi Chen (Addgene plasmid # 123363 ; http://n2t.net/addgene:123363 ; RRID:Addgene_123363) -
For your References section:
In vivo profiling of metastatic double knockouts through CRISPR-Cpf1 screens. Chow RD, Wang G, Ye L, Codina A, Kim HR, Shen L, Dong MB, Errami Y, Chen S. Nat Methods. 2019 May;16(5):405-408. doi: 10.1038/s41592-019-0371-5. Epub 2019 Apr 8. 10.1038/s41592-019-0371-5 PubMed 30962622