Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pKM19
(Plasmid #123655)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 123655 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pIEx
  • Backbone size w/o insert (bp) 3639
  • Total vector size (bp) 5337
  • Vector type
    Insect Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Firefly luciferase
  • Species
    Photinus pyralis (firefly)
  • Insert Size (bp)
    1698
  • Promoter pIEx

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GATAACCGCGTTGGTTTTA
  • 3′ sequencing primer CCAACTCCCATTGTTATTTCTATGCA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pLUC-MCS vector (Agilent Technologies, Santa Clara, CA USA) and pIEx-EGFP (Doug Brackney, The Connecticut Agricultural Experiment Station, New Haven, CT USA)
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid

Depositor Comments

The constitutive firefly luciferase expression plasmid pKM19 was generated by amplifying the firefly luciferase gene from pLUC-MCS and cloning it into pIEx-EGFP (a kind gift from Doug Brackney, The Connecticut Agricultural Experiment Station, New Haven, CT USA) after the EGFP sequence was removed by digestion with XhoI and NcoI, using In-Fusion cloning (Takara Biosciences, Mountain View, CA USA).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKM19 was a gift from Kevin Maringer (Addgene plasmid # 123655 ; http://n2t.net/addgene:123655 ; RRID:Addgene_123655)
  • For your References section:

    Aedes aegypti (Aag2)-derived clonal mosquito cell lines reveal the impact of pre-existing persistent infection with the insect-specific bunyavirus Phasi Charoen-like virus on arbovirus replication. Fredericks AC, Wallace LE, Russell TA, Davidson AD, Fernandez-Sesma A, Maringer K. bioRxiv April 1, 2019 10.1101/596205