KA1775_pPBCAG-rtTAM2-IH
(Plasmid
#124167)
-
PurposepiggyBac-based expression of rtTA-M2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124167 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneUnknown
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namertTAM2-IRES-Hph
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer TCTGCTAACCATGTTCATGC
- 3′ sequencing primer TATAGACAAACGCACACCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
KA1775_pPBCAG-rtTAM2-IH was a gift from Hans Schöler (Addgene plasmid # 124167 ; http://n2t.net/addgene:124167 ; RRID:Addgene_124167) -
For your References section:
Esrrb Unlocks Silenced Enhancers for Reprogramming to Naive Pluripotency. Adachi K, Kopp W, Wu G, Heising S, Greber B, Stehling M, Arauzo-Bravo MJ, Boerno ST, Timmermann B, Vingron M, Scholer HR. Cell Stem Cell. 2018 Aug 2;23(2):266-275.e6. doi: 10.1016/j.stem.2018.05.020. Epub 2018 Jun 14. 10.1016/j.stem.2018.05.020 PubMed 29910149