Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pTagGFP2-N SIN1 deltaNCD
(Plasmid #124920)


Item Catalog # Description Quantity Price (USD)
Plasmid 124920 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Alt name
  • Species
    H. sapiens (human)
  • Entrez Gene
    MAPKAP1 (a.k.a. JC310, MIP1, SIN1, SIN1b, SIN1g)
  • Tag / Fusion Protein
    • TagGFP2 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CMV Forward
  • 3′ sequencing primer TagGFP-Rev, GCGCACGCTGAACTTGTGGC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTagGFP2-N SIN1 deltaNCD was a gift from Jin Chen (Addgene plasmid # 124920 ; ; RRID:Addgene_124920)
  • For your References section:

    Disruption of scaffolding function of mLST8 selectively inhibits mTORC2 assembly and function and suppresses mTORC2-dependent tumor growth in vivo. Yoonha Hwang, Laura C Kim, Wenqiang Song, Deanna N Edwards, Rebecca S. Cook and Jin Chen. Cancer Research, May 2019 10.1158/0008-5472.CAN-18-3658