pET16B.Pfu
(Plasmid #12509)

• Purpose: Bacterial expression of Pfu DNA polymerase
• Depositing Lab: Sung-Hou Kim
• Publication: Goldman et al Acta Crystallogr D Biol Crystallogr. 1998 Sep 1. 54(Pt 5):986-8.

Backbone

• Vector backbone: pET16b
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5711
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Pfu DNA polymerase
• Species: P. furiosus
• Insert Size (bp): 2325
• Mutation: Y218H, Q462R, F533L, K559I and V683A (mutations were not intentional, but plasmid functions as described)
• GenBank ID: D12983

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the plasmid pET16B.Pfu contains an Ampicillin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1240, that confers spectinomycin resistance and allows for expression of genes with rare codons.

Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please transform BL21(DE3)Star bacterial cells with this plasmid and include pSJS1240 (Addgene plasmid number 12234), if necessary for expression of rare codons.

Addgene's sequencing results found Y218H, Q462R, F533L, K559I and V683A mutations in the Pfu sequence when compared to GenBank entry D12983. These mutations were not intentional, but plasmid functions as described in the associated publication listed below.