-
PurposeBacterial expression of Pfu DNA polymerase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 12509 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET16b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5711
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePfu DNA polymerase
-
SpeciesP. furiosus
-
Insert Size (bp)2325
-
MutationY218H, Q462R, F533L, K559I and V683A (mutations were not intentional, but plasmid functions as described)
-
GenBank IDD12983
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the plasmid pET16B.Pfu contains an Ampicillin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1240, that confers spectinomycin resistance and allows for expression of genes with rare codons.
Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please transform BL21(DE3)Star bacterial cells with this plasmid and include pSJS1240 (Addgene plasmid number 12234), if necessary for expression of rare codons.
Addgene's sequencing results found Y218H, Q462R, F533L, K559I and V683A mutations in the Pfu sequence when compared to GenBank entry D12983. These mutations were not intentional, but plasmid functions as described in the associated publication listed below.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET16B.Pfu was a gift from Sung-Hou Kim (Addgene plasmid # 12509 ; http://n2t.net/addgene:12509 ; RRID:Addgene_12509) -
For your References section:
Purification, crystallization and preliminary X-ray crystallographic analysis of Pyrococcus furiosus DNA polymerase. Goldman S, Kim R, Hung LW, Jancarik J, Kim SH. Acta Crystallogr D Biol Crystallogr. 1998 Sep 1. 54(Pt 5):986-8. 10.1107/S0907444998000353 PubMed 9757114