1
Plasmid 12509: pET16B.Pfu
  • Pfu DNA polymerase

  • 2325

  • P. furiosus

  • D12983

  • Y218H, Q462R, F533L, K559I and V683A

  • pET16b
    (Search Vector Database)

  • Novagen

  • Bacterial Expression

  • 5711

  • NdeI

  • No

  • XhoI

  • No

  • TAATACGACTCACTATAGGG List of Sequencing Primers

  • GCTAGTTATTGCTCAGCGG

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (3)
  • Sung-Hou Kim

  • MTA
    EMD Millipore Limited Use Label License/Brookhaven pET Assurance Letter

Comments: 

Please note that the plasmid pET16B.Pfu contains an Ampicillin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1240, that confers spectinomycin resistance and allows for expression of genes with rare codons.

Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please transform BL21(DE3)Star bacterial cells with this plasmid and include pSJS1240 (Addgene plasmid number 12234), if necessary for expression of rare codons.

Addgene's sequencing results found Y218H, Q462R, F533L, K559I and V683A mutations in the Pfu sequence when compared to GenBank entry D12983. This mutation was not intentional, but plasmid functions as described in the associated publication listed below.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Purification, crystallization and preliminary X-ray crystallographic analysis of Pyrococcus furiosus DNA polymerase. Goldman et al (Acta Crystallogr D Biol Crystallogr. 1998 Sep 1. 54(Pt 5):986-8. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 12509" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only