LEPG_shSik3.3974
(Plasmid
#125855)
-
PurposeRetroviral expression of mouse Sik3 shRNA with GFP and puromycin resistance gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 125855 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLEPG #111160
- Backbone size w/o insert (bp) 7900
-
Vector typeMammalian Expression, Retroviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA targeting Sik3
-
gRNA/shRNA sequenceTGCTGTTGACAGTGAGCGCCAGGATGAGGAAGATGAAGAATAGTGAAGCCACAGATGTATTCTTCATCTTCCTCATCCTGATGCCTACTGCCTCGGA
-
SpeciesM. musculus (mouse)
- Promoter MSCV-LTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer TGTTTGAATGAGGCTTCAGTAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/636969v1 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LEPG_shSik3.3974 was a gift from Christopher Vakoc (Addgene plasmid # 125855 ; http://n2t.net/addgene:125855 ; RRID:Addgene_125855) -
For your References section:
Salt-Inducible Kinase inhibition suppresses acute myeloid leukemia progression in vivo. Tarumoto Y, Lin S, Wang J, Milazzo JP, Xu Y, Lu B, Yang Z, Wei Y, Polyanskaya S, Wunderlich M, Gray NS, Stegmaier K, Vakoc CR. Blood. 2019 Nov 1. pii: 422697. doi: 10.1182/blood.2019001576. 10.1182/blood.2019001576 PubMed 31697837