pX330 Mouse 5' Npm1 gRNA
(Plasmid
#127900)
-
PurposeWT Cas9 Vector targeting the 5' end of the mouse Npm1 gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127900 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepX330
-
Modifications to backbonegRNA to 5' Npm1 inserted in BbsI cloning site
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA/Cas9
-
gRNA/shRNA sequencecatggaagactcgatggata
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer cacctctgacttgagcgtcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byhttps://www.addgene.org/42230/
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330 Mouse 5' Npm1 gRNA was a gift from Mark Groudine (Addgene plasmid # 127900 ; http://n2t.net/addgene:127900 ; RRID:Addgene_127900)