Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #128097)


Item Catalog # Description Quantity Price (USD)
Plasmid 128097 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    PX458 (pSpCas9(BB)-2A-GFP)
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 9271
  • Total vector size (bp) 9291
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
    CRISPR sgRNA against human 4EBP1
  • Alt name
    Eukaryotic translation initiation factor 4E-binding protein 1
  • Alt name
  • Alt name
  • gRNA/shRNA sequence
  • Species
    H. sapiens (human)
  • GenBank ID
  • Entrez Gene
    EIF4EBP1 (a.k.a. 4E-BP1, 4EBP1, BP-1, PHAS-I)
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer U6-Fwd primer (GAGGGCCTATTTCCCATGATTCC)
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX458-sgEIF4EBP1 was a gift from Chi Van Dang (Addgene plasmid # 128097 ; ; RRID:Addgene_128097)
  • For your References section:

    Acid Suspends the Circadian Clock in Hypoxia through Inhibition of mTOR. Walton ZE, Patel CH, Brooks RC, Yu Y, Ibrahim-Hashim A, Riddle M, Porcu A, Jiang T, Ecker BL, Tameire F, Koumenis C, Weeraratna AT, Welsh DK, Gillies R, Alwine JC, Zhang L, Powell JD, Dang CV. Cell. 2018 Jun 28;174(1):72-87.e32. doi: 10.1016/j.cell.2018.05.009. Epub 2018 May 31. 10.1016/j.cell.2018.05.009 PubMed 29861175