pAG109 H2B-FAST
(Plasmid
#130722)
-
PurposeExpresses FAST (also called YFAST) fused to zebrafish histone H2B in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 130722 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepIRES
- Backbone size w/o insert (bp) 4011
- Total vector size (bp) 4794
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH2B-FAST
-
Alt nameH2B-YFAST, H2B-FAST1
-
SpeciesSynthetic
-
Insert Size (bp)783
- Promoter CMV
-
Tag
/ Fusion Protein
- myc-tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG109 H2B-FAST was a gift from Arnaud Gautier (Addgene plasmid # 130722 ; http://n2t.net/addgene:130722 ; RRID:Addgene_130722) -
For your References section:
Small fluorescence-activating and absorption-shifting tag for tunable protein imaging in vivo. Plamont MA, Billon-Denis E, Maurin S, Gauron C, Pimenta FM, Specht CG, Shi J, Querard J, Pan B, Rossignol J, Moncoq K, Morellet N, Volovitch M, Lescop E, Chen Y, Triller A, Vriz S, Le Saux T, Jullien L, Gautier A. Proc Natl Acad Sci U S A. 2016 Jan 19;113(3):497-502. doi: 10.1073/pnas.1513094113. Epub 2015 Dec 28. 10.1073/pnas.1513094113 PubMed 26711992