Skip to main content
Addgene
Open Menu

3xIRS luciferase
(Plasmid #13511)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 13511 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 13511-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 13511-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pGL2-Promoter
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5800
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    3xIRS
  • Alt name
    Insulin-responsive sequence
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    150
  • Entrez Gene
    IGFBP1 (a.k.a. AFBP, IBP1, IGF-BP25, PP12, hIGFBP-1)
  • Tag / Fusion Protein
    • luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (destroyed during cloning)
  • 3′ cloning site XhoI (destroyed during cloning)
  • 5′ sequencing primer EBV rev primer
  • 3′ sequencing primer LucNrev primer
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Two oligonucleotides (GCAAAACAAACTTATTTTGAAGCAAAACAAACTTATTTTGAAGCAAAACAAACTTATTTTGAA and TCGATTCAAAATAAGTTTGTTTTGCTTCAAAATAAGTTTGTTTTGCTTCAAAATAAGTTTGTTTTGCGTAC) were annealed together and ligated into the pGL2-Promoter vector (Promega) to create 3×IRS-luciferase. The IRS sequences were derived from human IGFBP-1's IRS.

See "Author's Map" for more information.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    3xIRS luciferase was a gift from Kunliang Guan (Addgene plasmid # 13511 ; http://n2t.net/addgene:13511 ; RRID:Addgene_13511)

  • For your References section:

    Negative regulation of the forkhead transcription factor FKHR by Akt. Tang ED, Nunez G, Barr FG, Guan KL. J Biol Chem. 1999 Jun 11. 274(24):16741-6. 10.1074/jbc.274.24.16741 PubMed 10358014
Related items:
Commonly requested with: