Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

3xIRS luciferase
(Plasmid #13511)


Item Catalog # Description Quantity Price (USD)
Plasmid 13511 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5800
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    Insulin-responsive sequence
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    IGFBP1 (a.k.a. AFBP, IBP1, IGF-BP25, PP12, hIGFBP-1)
  • Tag / Fusion Protein
    • luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (destroyed during cloning)
  • 3′ cloning site XhoI (destroyed during cloning)
  • 5′ sequencing primer EBV rev primer
  • 3′ sequencing primer LucNrev primer
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Two oligonucleotides (GCAAAACAAACTTATTTTGAAGCAAAACAAACTTATTTTGAAGCAAAACAAACTTATTTTGAA and TCGATTCAAAATAAGTTTGTTTTGCTTCAAAATAAGTTTGTTTTGCTTCAAAATAAGTTTGTTTTGCGTAC) were annealed together and ligated into the pGL2-Promoter vector (Promega) to create 3×IRS-luciferase. The IRS sequences were derived from human IGFBP-1's IRS.

See "Author's Map" for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    3xIRS luciferase was a gift from Kunliang Guan (Addgene plasmid # 13511 ; ; RRID:Addgene_13511)
  • For your References section:

    Negative regulation of the forkhead transcription factor FKHR by Akt. Tang ED, Nunez G, Barr FG, Guan KL. J Biol Chem. 1999 Jun 11. 274(24):16741-6. 10.1074/jbc.274.24.16741 PubMed 10358014