Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-Ef1a-Flex-Axon-GCaMP7b
(Plasmid #135419)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 135419 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-Ef1a-DIO-Synaptophysin-GCaMP6s
  • Backbone manufacturer
    Rylan Larsen (Allen Institute for Brain Science)
  • Backbone size w/o insert (bp) 5897
  • Total vector size (bp) 6662
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    axon-jGCaMP7b
  • Alt name
    Axon-GCaMP3 variant 1561
  • Alt name
    Axon-Janelia-GCaMP7b
  • Species
    R. norvegicus (rat), G. gallus (chicken); A. victoria
  • Insert Size (bp)
    1568
  • Promoter Ef1a
  • Tags / Fusion Proteins
    • GAP43 palmitoylation domain (N terminal on insert)
    • 6xHis (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site SwaI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    GCaMP7b was synthesized based on sequences published by Douglas Kim and the Janelia Research Campus in Dana et al, 2019 PMID:31209382 . The Axon(Gap43) targeting sequence fused to GCaMP7b was previously published by Lin Tian's lab in Broussard et al, 2018 PMID: PMC6697169.
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-Flex-Axon-GCaMP7b was a gift from Rylan Larsen (Addgene plasmid # 135419 ; http://n2t.net/addgene:135419 ; RRID:Addgene_135419)