px330-GAPDH
(Plasmid
#136940)
-
PurposeNHEJ assay. sgRNA/Cas9 plasmid. Target DSB at human GAPDH; induce CD4+ deletion rearrangement by pairing w/ px330-CD4
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 136940 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepx330
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA targeting GAPDH
-
gRNA/shRNA sequenceGTATAGAAACCGGGGGCGCGG
-
SpeciesH. sapiens (human)
-
Entrez GeneGAPDH (a.k.a. G3PD, GAPD, HEL-S-162eP)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bbs1 (destroyed during cloning)
- 3′ cloning site Bbs1 (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
First G base in the sgRNA is not in the target locus, but is needed for transcription.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px330-GAPDH was a gift from Jeremy Stark (Addgene plasmid # 136940 ; http://n2t.net/addgene:136940 ; RRID:Addgene_136940) -
For your References section:
The canonical non-homologous end joining factor XLF promotes chromosomal deletion rearrangements in human cells. Bhargava R, Lopezcolorado FW, Tsai LJ, Stark JM. J Biol Chem. 2019 Nov 21. pii: RA119.010421. doi: 10.1074/jbc.RA119.010421. 10.1074/jbc.RA119.010421 PubMed 31753920