Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-Ef1a-Con/Foff 2.0-BFP
(Plasmid #137130)


Item Catalog # Description Quantity Price (USD)
Plasmid 137130 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5300
  • Vector type
    AAV, Cre/Lox, Synthetic Biology ; Flp/FRT

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    Con/Foff 2.0-BFP
  • Species
    Synthetic; Prokaryotic
  • Insert Size (bp)
  • Mutation
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer TGGAATTTGCCCTTTTTGAG
  • 3′ sequencing primer GGGCCACAACTCCTCATAAA
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-Con/Foff 2.0-BFP was a gift from Karl Deisseroth & INTRSECT 2.0 Project (Addgene plasmid # 137130 ; ; RRID:Addgene_137130)
  • For your References section:

    Comprehensive Dual- and Triple-Feature Intersectional Single-Vector Delivery of Diverse Functional Payloads to Cells of Behaving Mammals. Fenno LE, Ramakrishnan C, Kim YS, Evans KE, Lo M, Vesuna S, Inoue M, Cheung KYM, Yuen E, Pichamoorthy N, Hong ASO, Deisseroth K. Neuron. 2020 Jun 20. pii: S0896-6273(20)30432-3. doi: 10.1016/j.neuron.2020.06.003. 10.1016/j.neuron.2020.06.003 PubMed 32574559