pAAV-Ef1a-Con/Fon-oScarlet
(Plasmid #137136)

• Purpose: Intersectional viral expression of oScarlet in cells expressing both Cre AND Flp
• Depositing Labs: Karl Deisseroth, INTRSECT 2.0 Project
• Publication: Fenno et al Neuron. 2020 Jun 20. pii: S0896-6273(20)30432-3. doi: 10.1016/j.neuron.2020.06.003.

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	137136	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart
AAV8	137136-AAV8	Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. More Information	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30	$380	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: AAV2-EF1a-WPRE
  (Search Vector Database)
• Backbone size w/o insert (bp): 5300
• Vector type: AAV, Cre/Lox, Synthetic Biology ; Flp/FRT

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Con/Fon-oScarlet
• Species: Synthetic; Prokaryotic
• Insert Size (bp): 1300
• Mutation: E95D
• Promoter: EF1a

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: TGGAATTTGCCCTTTTTGAG
• 3′ sequencing primer: GGGCCACAACTCCTCATAAA

Resource Information

• Supplemental Documents:
  • pAAV-Ef1a-ConFon-oScarlet-WPRE.gb
• Terms and Licenses:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG

Information for AAV8 (Catalog # 137136-AAV8)

Purpose

Ready-to-use AAV8 particles produced from pAAV-Ef1a-Con/Fon-oScarlet (#137136). In addition to the viral particles, you will also receive purified pAAV-Ef1a-Con/Fon-oScarlet plasmid DNA.

EF1a-driven, Cre and Flp-dependent expression of oScarlet. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 1×10¹³ vg/mL
• Pricing: $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV8 cap gene
• Buffer: PBS + 0.001% Pluronic F-68
• Serotype: AAV8
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: oScarlet (Cre and Flp-dependent)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

• Terms and Licenses:
  • Ancillary Agreement for Penn Vectors
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.6% of viral vectors in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, we recommend titrating to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral vector dosage in order to reduce the likelihood of Cre-independent expression.