pAAV-Ef1a-Con/Fon-oScarlet
(Plasmid #137136)

• Purpose: Intersectional viral expression of oScarlet in cells expressing both Cre AND Flp
• Depositing Labs: Karl Deisseroth, INTRSECT 2.0 Project
• Publication: Fenno et al Neuron. 2020 Jun 20. pii: S0896-6273(20)30432-3. doi: 10.1016/j.neuron.2020.06.003.

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	137136	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: AAV2-EF1a-WPRE
  (Search Vector Database)
• Backbone size w/o insert (bp): 5300
• Vector type: AAV, Cre/Lox, Synthetic Biology ; Flp/FRT

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Con/Fon-oScarlet
• Species: Synthetic; Prokaryotic
• Insert Size (bp): 1300
• Mutation: E95D
• Promoter: EF1a

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: TGGAATTTGCCCTTTTTGAG
• 3′ sequencing primer: GGGCCACAACTCCTCATAAA

Resource Information

• Supplemental Documents:
  • pAAV-Ef1a-ConFon-oScarlet-WPRE.gb
• Terms and Licenses:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG