Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPN461
(Plasmid #137877)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 137877 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEP163
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    POGZ
  • gRNA/shRNA sequence
    TCCTCGGGTCAGACTACCGG
  • Species
    H. sapiens (human)
  • Entrez Gene
    POGZ (a.k.a. MRD37, WHSUS, ZNF280E, ZNF635, ZNF635m)

Cloning Information

  • Cloning method Gateway Cloning

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Additional insert: mRFP-T2A-BlasticidinR

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPN461 was a gift from Lindy Barrett (Addgene plasmid # 137877 ; http://n2t.net/addgene:137877 ; RRID:Addgene_137877)
  • For your References section:

    A multiplexed gRNA piggyBac transposon system facilitates efficient induction of CRISPRi and CRISPRa in human pluripotent stem cells. Hazelbaker DZ, Beccard A, Angelini G, Mazzucato P, Messana A, Lam D, Eggan K, Barrett LE. Sci Rep. 2020 Jan 20;10(1):635. doi: 10.1038/s41598-020-57500-1. 10.1038/s41598-020-57500-1 PubMed 31959800