Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1-Hyg-RFPKDEL
(Plasmid #138660)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 138660 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1-Hyg
  • Backbone manufacturer
    Thermofisher
  • Backbone size w/o insert (bp) 5570
  • Total vector size (bp) 6362
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RFP-KDEL
  • Alt name
    Red fluorescent protein ER-located
  • Species
    Synthetic
  • Insert Size (bp)
    792
  • Promoter CMV
  • Tag / Fusion Protein
    • KDEL (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GGCTAACTAGAGAACCCACTG
  • 3′ sequencing primer GGCAACTAGAAGGCACAGTC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-Hyg-RFPKDEL was a gift from Bertrand Collet (Addgene plasmid # 138660 ; http://n2t.net/addgene:138660 ; RRID:Addgene_138660)
  • For your References section:

    Viral Resistance and IFN Signaling in STAT2 Knockout Fish Cells. Dehler CE, Lester K, Della Pelle G, Jouneau L, Houel A, Collins C, Dovgan T, Machat R, Zou J, Boudinot P, Martin SAM, Collet B. J Immunol. 2019 Jul 15;203(2):465-475. doi: 10.4049/jimmunol.1801376. Epub 2019 May 29. 10.4049/jimmunol.1801376 PubMed 31142600