pSBBi-Pur GFP-TM
(Plasmid #139185)

• Purpose: SB-transposon with constitutive bi-directional promoter. One side contains transmembrane-anchored GFP; the other side contains the puromycin resistance gene.
• Depositing Lab: Neal Devaraj
• Publication: Methylxanthine Synthesis in Human Cells (unpublished)

Backbone

• Vector backbone: pSBBi-Pur
• Backbone size w/o insert (bp): 5857
• Total vector size (bp): 6618
• Vector type: Mammalian Expression ; Transposon
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GFP-TM
• Alt name: surface GFP
• Alt name: EGFP Ligand
• Species: Aequorea victoria
• Insert Size (bp): 933
• Mutation: fused to membrane anchor
• GenBank ID:
• Promoter: EF1α

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pSBBi-Pur GFP-TM.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

SB-transposon with constitutive bi-directional promoter. One side contains surface-anchored EGFP; the other side contains puromycin resistance .