-
PurposeMammalian expression of Piezo1-based fluorescent force sensor GenEPi
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140236 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 3975
- Total vector size (bp) 12912
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGenEPi (Piezo1-based fluorescent force sensor)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)7568
-
Entrez GenePIEZO1 (a.k.a. DHS, ER, FAM38A, LMPH3, LMPHM6, Mib)
- Promoter simian CMV IE94
-
Tag
/ Fusion Protein
- GCaMP 6s RS1 EF4 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer gaggtctatataagcagagctgg
- 3′ sequencing primer GGCAAGCTGACCCTGAAGTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/702423 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-GenEPi was a gift from Periklis Pantazis (Addgene plasmid # 140236 ; http://n2t.net/addgene:140236 ; RRID:Addgene_140236) -
For your References section:
Highly specific and non-invasive imaging of Piezo1-dependent activity across scales using GenEPi. Yaganoglu S, Kalyviotis K, Vagena-Pantoula C, Julich D, Gaub BM, Welling M, Lopes T, Lachowski D, Tang SS, Hernandez ADR, Salem V, Muller DJ, Holley SA, Vermot J, Shi J, Helassa N, Torok K, Pantazis P. Nat Commun. 2023 Jul 19;14(1):4352. doi: 10.1038/s41467-023-40134-y. 10.1038/s41467-023-40134-y PubMed 37468521