pCMV-GenEPi
(Plasmid #140236)

• Purpose: Mammalian expression of Piezo1-based fluorescent force sensor GenEPi
• Depositing Lab: Periklis Pantazis
• Publication: Yaganoglu et al Nat Commun. 2023 Jul 19;14(1):4352. doi: 10.1038/s41467-023-40134-y.

Backbone

• Vector backbone: pCMV
• Backbone size w/o insert (bp): 3975
• Total vector size (bp): 12912
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GenEPi (Piezo1-based fluorescent force sensor)
• Species: H. sapiens (human)
• Insert Size (bp): 7568
• Entrez Gene: PIEZO1 (a.k.a. DHS, ER, FAM38A, LMPH3, LMPHM6, Mib)
• Promoter: simian CMV IE94
• Tag / Fusion Protein:
  • GCaMP 6s RS1 EF4 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: gaggtctatataagcagagctgg
• 3′ sequencing primer: GGCAAGCTGACCCTGAAGTT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/702423 for bioRxiv preprint.