pLenti-PGK-Venus-Fluc (puro)
(Plasmid #140328)

• Purpose: Lentivirus for expression of Venus-Fluc (firefly luciferase) fusion protein
• Depositing Lab: Roland Friedel
• Publication: Bozec et al Neurooncol Adv. 2020 Oct 10;2(1):vdaa134. doi: 10.1093/noajnl/vdaa134. eCollection 2020 Jan-Dec.

Backbone

• Vector backbone: pLenti PGK Puro DEST (Addgene #19068)
• Backbone manufacturer: Eric Campeau & Paul Kaufman
• Backbone size w/o insert (bp): 9599
• Total vector size (bp): 10372
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Venus-Firefly Luciferase (luc2)
• Species: Synthetic; Aequorea victoria (Venus) and Photinus pyralis (luciferase)
• Insert Size (bp): 2400
• Promoter: human PGK promoter

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: hPGK-F GTGTTCCGCATTCTGCAAG
• 3′ sequencing primer: WPRE-R catagcgtaaaaggagcaaca

Resource Information

• Supplemental Documents:
  • pLenti-PGK-Venus-Fluc (puro)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The Firefly luciferase gene was retrieved from Addgene plasmid MSCV-Fluc PGK-hygro (Addgene #18782) and added in frame behind a Venus cDNA. The pLenti-PGK-Venus-Fluc is in its structure identical to pLenti-PGK-Venus-Akaluc (Addgene #124701), except the different Luciferase version.