1
Plasmid 14490: pIS47 C20orf139 3'UTR mut
  • C20orf139 3'UTR mutant

  • C20orf139

  • 520

  • H. sapiens (human)

  • SRXN1 (Npn3, SRX1, YKL086W, FLJ43353, C20orf139, dJ850E9.2)

  • luciferase

  • N terminal on backbone

  • CATTCC’s were changed to AAGTAC's

  • pIS1
    (Search Vector Database)

  • Bartel Lab

  • Mammalian Expression, Luciferase

  • 4085

  • SacI

  • No

  • XbaI

  • No

  • n/a List of Sequencing Primers

  • EBV rev primer (GTGGTTTGTCCAAACTCATC)

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (1)
  • David Bartel

  • MTA
    Luciferase Limited Use Label License

Comments: 

C20orf139 3'UTR mutant in renilla luciferase reporter plasmid.

This plasmid has not been sequence verified. If you would like Addgene to sequence a portion of this plasmid before you request it, please contact us.

Article: Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Lim et al (Nature. 2005 Feb 17. 433(7027):769-73. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 14490" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with