Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pIS50 KIF2 3'UTR
(Plasmid #14493)


Item Catalog # Description Quantity Price (USD)
Plasmid 14493 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Bartel Lab
  • Backbone size w/o insert (bp) 4085
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    KIF2 3'UTR
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    KIF2A (a.k.a. CDCBM3, HK2, KIF2)
  • Tag / Fusion Protein
    • luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer n/a
  • 3′ sequencing primer EBV rev primer (GTGGTTTGTCCAAACTCATC)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

KIF2 3'UTR in renilla luciferase reporter plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIS50 KIF2 3'UTR was a gift from David Bartel (Addgene plasmid # 14493 ; ; RRID:Addgene_14493)
  • For your References section:

    Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM, Castle J, Bartel DP, Linsley PS, Johnson JM. Nature. 2005 Feb 17. 433(7027):769-73. 10.1038/nature03315 PubMed 15685193