1
Plasmid 14503: pAG17 IQGAP1 3'UTR
  • IQGAP1 3'UTR

  • IQGAP1

  • 820

  • H. sapiens (human)

  • luciferase

  • N terminal on backbone

  • pIS2
    (Search Vector Database)

  • pIS2 derived from pRL-SV40 (Promega)

  • Mammalian Expression, Luciferase

  • 3700

  • SacI

  • No

  • XbaI

  • No

  • EBV rev primer (GTGGTTTGTCCAAACTCATC) List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • David Bartel

  • MTA
    Luciferase Limited Use Label License

Comments: 

IQGAP1 3'UTR in renilla luciferase reporter plasmid.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Lim et al (Nature. 2005 Feb 17. 433(7027):769-73. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 14503" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only