Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Hmga2 3'UTR wt luciferase (Luc-wt)
(Plasmid #14785)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 14785 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pIS1
  • Backbone manufacturer
    Available from Addgene (#12179)
  • Backbone size w/o insert (bp) 4000
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Luc-wt
  • Alt name
    HMGA2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3000
  • GenBank ID
    BC052158
  • Entrez Gene
    Hmga2 (a.k.a. 9430083A20Rik, HMGI-C, Hmgic, pg, pygmy)
  • Tag / Fusion Protein
    • luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer N/A
  • 3′ sequencing primer EBV rev primer
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). To construct the Renilla luciferase reporters, wild-type and mutant Hmga2 3' UTRs were amplified (PCR primers, 5'-GCGTCTCGAGGGGCGCCGACATTC and 5'GGCGCGGCCGCAGTCAGAGGGCACAC) and cloned into the XbaI and NotI sites of pIS1.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Hmga2 3'UTR wt luciferase (Luc-wt) was a gift from David Bartel (Addgene plasmid # 14785 ; http://n2t.net/addgene:14785 ; RRID:Addgene_14785)
  • For your References section:

    Disrupting the pairing between let-7 and Hmga2 enhances oncogenic transformation. Mayr C, Hemann MT, Bartel DP. Science. 2007 Mar 16. 315(5818):1576-9. 10.1126/science.1137999 PubMed 17322030