Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCS2+-N-PAS2-GAF-PHYB-MCherry-CAAX
(Plasmid #154910)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 154910 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCS2+
  • Backbone manufacturer
    RZPD
  • Backbone size w/o insert (bp) 4095
  • Total vector size (bp) 6791
  • Vector type
    Mammalian Expression ; xenopus/avian/zebrafish

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Phytochrome B
  • Alt name
    PHYB
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    2676
  • Mutation
    1-621 amino acids of Arabidopsis PHYB
  • GenBank ID
    816394
  • Entrez Gene
    PHYB (a.k.a. AT2G18790, HY3, MSF3.17, MSF3_17, OOP1, OUT OF PHASE 1, PHYTOCHROME B, phytochrome B)
  • Promoter CMV
  • Tags / Fusion Proteins
    • mCherry (C terminal on insert)
    • CAAX membrane moiety (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer SP6 Forward ATTTAGGTGACACTATAG
  • 3′ sequencing primer M13 Reverse GGAAACAGCTATGACCATG, T3 Forward AATTAACCCTCACTAAAGGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS2+-N-PAS2-GAF-PHYB-MCherry-CAAX was a gift from Clare Buckley & Jonathan Clarke (Addgene plasmid # 154910 ; http://n2t.net/addgene:154910 ; RRID:Addgene_154910)
  • For your References section:

    Reversible Optogenetic Control of Subcellular Protein Localization in a Live Vertebrate Embryo. Buckley CE, Moore RE, Reade A, Goldberg AR, Weiner OD, Clarke JD. Dev Cell. 2016 Jan 11;36(1):117-26. doi: 10.1016/j.devcel.2015.12.011. 10.1016/j.devcel.2015.12.011 PubMed 26766447