Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #155120)


Item Catalog # Description Quantity Price (USD)
Plasmid 155120 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pDestTol2CG2 (Tol2 kit 1.0 #395)
  • Backbone manufacturer
    Esther Fujimoto, Chien lab
  • Backbone size w/o insert (bp) 6251
  • Total vector size (bp) 9298
  • Modifications to backbone
    cmlc2:GFP replaced with cmlc2:membrane-mRFP in reverse orientation
  • Vector type
    Zebrafish expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    D. rerio (zebrafish), S. cerevisiae (budding yeast); Neurospora crassa
  • Insert Size (bp)
  • GenBank ID
    855828 3875756
  • Entrez Gene
    hsp70l (a.k.a. HSP70, hsp70-4)
  • Promoter hsp70l

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gctgcaaatagcaggaaacg
  • 3′ sequencing primer GAGGATCATAATCAGCCATA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTol2CG2-hsp70I:QFGal4-SV40pA was a gift from Bret Pearson (Addgene plasmid # 155120 ; ; RRID:Addgene_155120)
  • For your References section:

    An optimized QF-binary expression system for use in zebrafish. Burgess J, Burrows JT, Sadhak R, Chiang S, Weiss A, D'Amata C, Molinaro AM, Zhu S, Long M, Hu C, Krause HM, Pearson BJ. Dev Biol. 2020 Jul 19. pii: S0012-1606(20)30202-5. doi: 10.1016/j.ydbio.2020.07.007. 10.1016/j.ydbio.2020.07.007 PubMed 32697972