Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pTR-UF11
(Plasmid #157970)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 157970 Standard format: Plasmid sent in bacteria as agar stab 1 $75
AAV2 in TMN200 157970-AAV.A01.T Virus (20 µL at titer ≥ 1×10¹² vg/mL) and Plasmid.
$130
AAV2 in PBS 157970-AAV.A02.T Virus (20 µL at titer ≥ 5×10¹¹ vg/mL) and Plasmid.
$130
AAV2 in BSS 157970-AAV.A03.T Virus (20 µL at titer ≥ 1×10¹² vg/mL) and Plasmid.
$130
AAV2 (Y444F) in TMN200 157970-AAV.A04.T Virus (20 µL at titer ≥ 1×10¹² vg/mL) and Plasmid.
$130
AAV2 (Y444F) in BSS 157970-AAV.A05.T Virus (20 µL at titer ≥ 1×10¹² vg/mL) and Plasmid.
$130
AAV2 (trpYF) in TMN200 157970-AAV.A06.T Virus (20 µL at titer ≥ 1×10¹² vg/mL) and Plasmid.
$130
AAV2 (trpYF) in BSS 157970-AAV.A07.T Virus (20 µL at titer ≥ 1×10¹² vg/mL) and Plasmid.
$130
AAV2(4pMut)dHS in BSS 157970-AAV.A08.T Virus (20 µL at titer ≥ 1×10¹² vg/mL) and Plasmid.
$130
AAV6 in TMN200 157970-AAV.A09.T Virus (20 µL at titer ≥ 1×10¹² vg/mL) and Plasmid.
$130
AAV6(dbY-F+T-V) in TMN200 157970-AAV.A10.T Virus (20 µL at titer ≥ 1×10¹² vg/mL) and Plasmid.
$130
AAV44.9 in PBS 157970-AAV.A11.T Virus (20 µL at titer ≥ 1×10¹² vg/mL) and Plasmid.
$130
AAV44.9(E531D) in PBS 157970-AAV.A12.T Virus (20 µL at titer ≥ 1×10¹² vg/mL) and Plasmid.
$130

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC
  • Modifications to backbone
    Contains AAV2 ITRs
  • Vector type
    AAV
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    'humanized' e.g. codon optimized GFP
  • Alt name
    hGFP
  • Species
    Synthetic
  • Promoter chimeric CMV/Chicken Beta actin (CBA)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer ACAGCTCCTGGGCAACGTGC
  • 3′ sequencing primer TGCATTCTAGTTGTGGTTTGTCC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This plasmid may be prone to ITR instability. It is recommended to store the plasmid in an E. coli strain such as NEB stable and to verify by SmaI digest. See the Resource Information section for a digest from Addgene's stock.

Information for AAV2 in TMN200 (Catalog # 157970-AAV.A01.T) ( Back to top )

Purpose

Ready-to-use AAV2 in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

  • Volume 20 µL
  • Titer ≥ 1×10¹² vg/mL
  • Pricing $100 USD for preparation of 20 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV2 cap gene
  • Buffer TMN200 (200mM sodium chloride, 1mM magnesium chloride, 20mM Tris at pH 8.0) supplemented with 0.001% pluronic F68 or 0.014% Tween 20
  • Serotype AAV2
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Certificate of Analysis (CoA)

Visit our viral production page for more information.

Addgene Comments

TMN200 is a buffer optimized for maintaining AAV solubility. TMN200 is suitable for in vitro as well as in vivo delivery where the vector is diluted by the physiologic body fluids, such as blood, vitreous, CSF, etc. TMN200 is not suitable as a buffer for vectors delivered directly to the brain parenchyma or subretinal space.

Information for AAV2 in PBS (Catalog # 157970-AAV.A02.T) ( Back to top )

Purpose

Ready-to-use AAV2 in PBS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

  • Volume 20 µL
  • Titer ≥ 5×10¹¹ vg/mL
  • Pricing $100 USD for preparation of 20 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV2 cap gene
  • Buffer PBS supplemented with 0.001% pluronic F68 or 0.014% Tween 20
  • Serotype AAV2
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Certificate of Analysis (CoA)

Visit our viral production page for more information.

Addgene Comments

PBS is a universal buffer suitable for any application.

Information for AAV2 in BSS (Catalog # 157970-AAV.A03.T) ( Back to top )

Purpose

Ready-to-use AAV2 in BSS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

  • Volume 20 µL
  • Titer ≥ 1×10¹² vg/mL
  • Pricing $100 USD for preparation of 20 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV2 cap gene
  • Buffer BSS supplemented with 0.001% pluronic F68 or 0.014% Tween 20
  • Serotype AAV2
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Certificate of Analysis (CoA)

Visit our viral production page for more information.

Addgene Comments

BSS is an ophthalmic solution suitable for any application.

Information for AAV2 (Y444F) in TMN200 (Catalog # 157970-AAV.A04.T) ( Back to top )

Purpose

Ready-to-use AAV2 (Y444F) in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

  • Volume 20 µL
  • Titer ≥ 1×10¹² vg/mL
  • Pricing $100 USD for preparation of 20 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV2(Y444F) cap gene
  • Buffer TMN200 (200mM sodium chloride, 1mM magnesium chloride, 20mM Tris at pH 8.0) supplemented with 0.001% pluronic F68 or 0.014% Tween 20
  • Serotype AAV2(Y444F). The AAV2(Y444F) mutant is derived from AAV2 with the following mutation, Y444F.
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Certificate of Analysis (CoA)

Visit our viral production page for more information.

Addgene Comments

TMN200 is a buffer optimized for maintaining AAV solubility. TMN200 is suitable for in vitro as well as in vivo delivery where the vector is diluted by the physiologic body fluids, such as blood, vitreous, CSF, etc. TMN200 is not suitable as a buffer for vectors delivered directly to the brain parenchyma or subretinal space.

Information for AAV2 (Y444F) in BSS (Catalog # 157970-AAV.A05.T) ( Back to top )

Purpose

Ready-to-use AAV2 (Y444F) in BSS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

  • Volume 20 µL
  • Titer ≥ 1×10¹² vg/mL
  • Pricing $100 USD for preparation of 20 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV2(Y444F) cap gene
  • Buffer BSS supplemented with 0.001% pluronic F68 or 0.014% Tween 20.
  • Serotype AAV2(Y444F). The AAV2(Y444F) mutant is derived from AAV2 with the following mutation, Y444F.
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Certificate of Analysis (CoA)

Visit our viral production page for more information.

Addgene Comments

BSS is an ophthalmic solution suitable for any application.

Information for AAV2 (trpYF) in TMN200 (Catalog # 157970-AAV.A06.T) ( Back to top )

Purpose

Ready-to-use AAV2 (trpYF) in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

  • Volume 20 µL
  • Titer ≥ 1×10¹² vg/mL
  • Pricing $100 USD for preparation of 20 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV2 (trpYF) cap gene
  • Buffer TMN200 (200mM sodium chloride, 1mM magnesium chloride, 20mM Tris at pH 8.0) supplemented with 0.001% pluronic F68 or 0.014% Tween 20
  • Serotype AAV2 (trpYF). The AAV2 (trpYF) mutant is derived from the AAV2 capsid and contains the following mutations, Y444F, Y500F and Y730F.
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Certificate of Analysis (CoA)

Visit our viral production page for more information.

Addgene Comments

TMN200 is a buffer optimized for maintaining AAV solubility. TMN200 is suitable for in vitro as well as in vivo delivery where the vector is diluted by the physiologic body fluids, such as blood, vitreous, CSF, etc. TMN200 is not suitable as a buffer for vectors delivered directly to the brain parenchyma or subretinal space.

Information for AAV2 (trpYF) in BSS (Catalog # 157970-AAV.A07.T) ( Back to top )

Purpose

Ready-to-use AAV2 (trpYF) in BSS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

  • Volume 20 µL
  • Titer ≥ 1×10¹² vg/mL
  • Pricing $100 USD for preparation of 20 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV2 (trpYF) cap gene
  • Buffer BSS supplemented with 0.001% pluronic F68 or 0.014% Tween 20.
  • Serotype AAV2 (trpYF). The AAV2 (trpYF) mutant is derived from the AAV2 capsid and contains the following mutations, Y444F, Y500F and Y730F.
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Certificate of Analysis (CoA)

Visit our viral production page for more information.

Addgene Comments

BSS is an ophthalmic solution suitable for any application.

Information for AAV2(4pMut)dHS in BSS (Catalog # 157970-AAV.A08.T) ( Back to top )

Purpose

Ready-to-use AAV2(4pMut)dHS in BSS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

  • Volume 20 µL
  • Titer ≥ 1×10¹² vg/mL
  • Pricing $100 USD for preparation of 20 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV2(4pMut)dHS cap gene
  • Buffer BSS supplemented with 0.001% pluronic F68 or 0.014% Tween 20.
  • Serotype AAV2(4pMut)dHS. The AAV2(4pMut)dHS serotype is derived from AAV2 with the following mutations, Y444F, Y500F, Y730F, T491V, R487G, R585S and R588T.
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Certificate of Analysis (CoA)

Visit our viral production page for more information.

Addgene Comments

BSS is an ophthalmic solution suitable for any application.

Information for AAV6 in TMN200 (Catalog # 157970-AAV.A09.T) ( Back to top )

Purpose

Ready-to-use AAV6 in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

  • Volume 20 µL
  • Titer ≥ 1×10¹² vg/mL
  • Pricing $100 USD for preparation of 20 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV6 cap gene
  • Buffer TMN200 (200mM sodium chloride, 1mM magnesium chloride, 20mM Tris at pH 8.0) supplemented with 0.001% pluronic F68 or 0.014% Tween 20
  • Serotype AAV6
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Certificate of Analysis (CoA)

Visit our viral production page for more information.

Addgene Comments

TMN200 is a buffer optimized for maintaining AAV solubility. TMN200 is suitable for in vitro as well as in vivo delivery where the vector is diluted by the physiologic body fluids, such as blood, vitreous, CSF, etc. TMN200 is not suitable as a buffer for vectors delivered directly to the brain parenchyma or subretinal space.

Information for AAV6(dbY-F+T-V) in TMN200 (Catalog # 157970-AAV.A10.T) ( Back to top )

Purpose

Ready-to-use AAV6(dbY-F+T-V) in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

  • Volume 20 µL
  • Titer ≥ 1×10¹² vg/mL
  • Pricing $100 USD for preparation of 20 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV6(dbY-F+T-V) cap gene
  • Buffer TMN200 (200mM sodium chloride, 1mM magnesium chloride, 20mM Tris at pH 8.0) supplemented with 0.001% pluronic F68 or 0.014% Tween 20
  • Serotype AAV6(dbY-F+T-V). The AAV6(dbY-F+T-V) serotype is derived from AAV6 and contains the following mutations, Y705F, Y731F and T492V.
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Certificate of Analysis (CoA)

Visit our viral production page for more information.

Addgene Comments

TMN200 is a buffer optimized for maintaining AAV solubility. TMN200 is suitable for in vitro as well as in vivo delivery where the vector is diluted by the physiologic body fluids, such as blood, vitreous, CSF, etc. TMN200 is not suitable as a buffer for vectors delivered directly to the brain parenchyma or subretinal space.

Information for AAV44.9 in PBS (Catalog # 157970-AAV.A11.T) ( Back to top )

Purpose

Ready-to-use AAV44.9 in PBS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

  • Volume 20 µL
  • Titer ≥ 1×10¹² vg/mL
  • Pricing $100 USD for preparation of 20 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV44.9 cap gene
  • Buffer PBS supplemented with 0.001% pluronic F68 or 0.014% Tween 20
  • Serotype AAV44.9
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Certificate of Analysis (CoA)

Visit our viral production page for more information.

Addgene Comments

PBS is a universal buffer suitable for any application.

Information for AAV44.9(E531D) in PBS (Catalog # 157970-AAV.A12.T) ( Back to top )

Purpose

Ready-to-use AAV44.9(E531D) in PBS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

  • Volume 20 µL
  • Titer ≥ 1×10¹² vg/mL
  • Pricing $100 USD for preparation of 20 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV44.9(E531D) cap gene
  • Buffer PBS supplemented with 0.001% pluronic F68 or 0.014% Tween 20
  • Serotype AAV44.9(E531D). The AAV44.9(E531D) serotype is derived from AAV44.9 and contains the following mutation, E531D.
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Certificate of Analysis (CoA)

Visit our viral production page for more information.

Addgene Comments

PBS is a universal buffer suitable for any application.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTR-UF11 was a gift from Sergei Zolotukhin (Addgene plasmid # 157970 ; http://n2t.net/addgene:157970 ; RRID:Addgene_157970)

    For viral preps, please replace (Addgene plasmid # 157970) in the above sentence with: (Addgene viral prep # 157970-AAV.A01.T), (Addgene viral prep # 157970-AAV.A02.T), (Addgene viral prep # 157970-AAV.A03.T), (Addgene viral prep # 157970-AAV.A04.T), (Addgene viral prep # 157970-AAV.A05.T), (Addgene viral prep # 157970-AAV.A06.T), (Addgene viral prep # 157970-AAV.A07.T), (Addgene viral prep # 157970-AAV.A08.T), (Addgene viral prep # 157970-AAV.A09.T), (Addgene viral prep # 157970-AAV.A10.T), (Addgene viral prep # 157970-AAV.A11.T), or (Addgene viral prep # 157970-AAV.A12.T)

  • For your References section:

    Recombinant AAV viral vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell tropism after delivery to different regions of the central nervous system. Burger C, Gorbatyuk OS, Velardo MJ, Peden CS, Williams P, Zolotukhin S, Reier PJ, Mandel RJ, Muzyczka N. Mol Ther. 2004 Aug;10(2):302-17. doi: 10.1016/j.ymthe.2004.05.024. 10.1016/j.ymthe.2004.05.024 PubMed 15294177