Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pT7-AsCas12a_crRNA-site4 (MSP3511)
(Plasmid #160139)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 160139 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    DR274 (Addgene plasmid #42250)
  • Vector type
    in vitro transcription of sgRNA from T7 promoter

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
  • Alt name
    MSP3511
  • gRNA/shRNA sequence
    GGAATCCCTTCTGCAGCACCTGG
  • Species
    Synthetic
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer M13F - TGTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT7-AsCas12a_crRNA-site4 (MSP3511) was a gift from Keith Joung & Benjamin Kleinstiver (Addgene plasmid # 160139 ; http://n2t.net/addgene:160139 ; RRID:Addgene_160139)
  • For your References section:

    Scalable characterization of the PAM requirements of CRISPR-Cas enzymes using HT-PAMDA. Walton RT, Hsu JY, Joung JK, Kleinstiver BP. Nat Protoc. 2021 Feb 5. pii: 10.1038/s41596-020-00465-2. doi: 10.1038/s41596-020-00465-2. 10.1038/s41596-020-00465-2 PubMed 33547443