Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSCAR_sgRNA_hygro-tagBFP-lox2272
(Plasmid #162078)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 162078 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRDA_118
  • Backbone manufacturer
    Broad Institute
  • Backbone size (bp) 8332
  • Modifications to backbone
    EF1a-PuroR cassette replaced with synthesized EF1a-hygroR-2a-tagBFP_lox2272 cassette using traditional restriction enzyme cloning with XmaI and MluI
  • Vector type
    Mammalian Expression, Lentiviral, Cre/Lox, CRISPR
  • Promoter U6, EF1a
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer GGAGGAGAAAATGAAAGCCATACGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSCAR_sgRNA_hygro-tagBFP-lox2272 was a gift from Robert Manguso (Addgene plasmid # 162078 ; http://n2t.net/addgene:162078 ; RRID:Addgene_162078)
  • For your References section:

    In vivo screens using a selective CRISPR antigen removal lentiviral vector system reveal immune dependencies in renal cell carcinoma. Dubrot J, Lane-Reticker SK, Kessler EA, Ayer A, Mishra G, Wolfe CH, Zimmer MD, Du PP, Mahapatra A, Ockerman KM, Davis TGR, Kohnle IC, Pope HW, Allen PM, Olander KE, Iracheta-Vellve A, Doench JG, Haining WN, Yates KB, Manguso RT. Immunity. 2021 Jan 20. pii: S1074-7613(21)00001-7. doi: 10.1016/j.immuni.2021.01.001. 10.1016/j.immuni.2021.01.001 PubMed 33497609