Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUHG10.3-TetO-Rs1
(Plasmid #16313)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 16313 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUHG10-3
  • Backbone size w/o insert (bp) 3705
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    h5HT4b Serotonin Receptor (Rs1 D100A RASSL)
  • Alt name
    Rs1
  • Alt name
    D100A
  • Alt name
    5HT4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1745
  • Mutation
    Added FLAG tag; Changed Aspartic Acid 100 to Alanine.
  • Entrez Gene
    RS1 (a.k.a. RS, XLRS1)
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CCACGCTGTTTTGACCTCC
  • 3′ sequencing primer CCCTGAAAACTTTGCCCCCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUHG10.3-TetO-Rs1 was a gift from Bruce Conklin (Addgene plasmid # 16313 ; http://n2t.net/addgene:16313 ; RRID:Addgene_16313)
  • For your References section:

    Osteoblast expression of an engineered Gs-coupled receptor dramatically increases bone mass. Hsiao EC, Boudignon BM, Chang WC, Bencsik M, Peng J, Nguyen TD, Manalac C, Halloran BP, Conklin BR, Nissenson RA. Proc Natl Acad Sci U S A. 2008 Jan 29. 105(4):1209-14. 10.1073/pnas.0707457105 PubMed 18212126