Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p8092 LentiCRISPR v2 sgNT-1
(Plasmid #163315)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 163315 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    LentiCRISPR v2
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgNT-1
  • gRNA/shRNA sequence
    AGCTCGCCATGTCGGTTCTC
  • Species
    Synthetic
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer Human U6.F
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p8092 LentiCRISPR v2 sgNT-1 was a gift from Elizabeth White (Addgene plasmid # 163315 ; http://n2t.net/addgene:163315 ; RRID:Addgene_163315)
  • For your References section:

    A Conserved Amino Acid in the C Terminus of Human Papillomavirus E7 Mediates Binding to PTPN14 and Repression of Epithelial Differentiation. Hatterschide J, Brantly AC, Grace M, Munger K, White EA. J Virol. 2020 Aug 17;94(17). pii: JVI.01024-20. doi: 10.1128/JVI.01024-20. Print 2020 Aug 17. 10.1128/JVI.01024-20 PubMed 32581101