pTBL1269 pLenti-CHYRON17-pEF1a(short)-Luc2-P2A-tdTomato-T2A-TdT
(Plasmid #163643)

• Purpose: Makes a lentivirus that expresses hgRNA with 17nt spacer and Luc2, tdTomato, and human TdT.
• Depositing Lab: Chang Liu
• Publication: Loveless et al Nat Chem Biol. 2021 Jun;17(6):739-747. doi: 10.1038/s41589-021-00769-8. Epub 2021 Mar 22.

Backbone

• Vector backbone: lenti, 3rd generation
• Backbone manufacturer: Phil Sharp and Feng Zhang, Addgene Plasmid #63592
• Backbone size w/o insert (bp): 8251
• Total vector size (bp): 13228
• Modifications to backbone: Added a pU6-hgRNA expression cassette and pEFS-Luc2-P2A-tdTomato-T2A-human TdT
• Vector type: Lentiviral
• Selectable markers: tdTomato

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Cells can be grown at 37C, but growth at 30C is recommended for NEBStable.
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: pU6-CHYRON17 hgRNA
• Species: Synthetic
• Insert Size (bp): 349
• Mutation: The SpCas9 sgRNA constant region is mutated to make it self-targeting.
• Promoter: pU6

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: AAGTAAGACCACCGCACAGC
• 3′ sequencing primer: TGCTGTCCCTGTAATAAACC

Gene/Insert 2

• Gene/Insert name: Luc2-P2A-tdTomato-T2A-human TdT
• Alt name: terminal deoxynucleotidyl transferase
• Species: H. sapiens (human)
• Insert Size (bp): 4752
• Entrez Gene: DNTT (a.k.a. TDT)
• Promoter: EFS
• Tag / Fusion Protein:
  • Luc2-P2A-tdTomato-T2A (N terminal on backbone)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AAAGTGATGTCGTGTACTGG
• 3′ sequencing primer: AGCAGCGTATCCACATAGCG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pU6 is from pSQT1313, Addgene Plasmid #53370, made by the Keith Joung lab. The Luc2-P2A-tdTomato sequence is from pCDH-EF1-Luc2-P2A-tdTomato, Addgene Plasmid #72486, made by the Kazuhiro Oka lab.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The mutations that make the sgRNA scaffold self-targeting or homing are described in Perli et al., 2016, doi: 10.1126/science.aag0511 and Kalhor et al., 2017, doi: 10.1038/nmeth.4108.

This is a 3rd generation lentiviral transfer plasmid. Please visit https://doi.org/10.1101/639120 for bioRxiv preprint.