pUltraI-Tet3.0[TAA]
(Plasmid #164580)

• Purpose: Machinery plasmid containing a single copy of the Mb Tet3.0RS and cognate tRNA for incorporation of Tet3.0 at TAA codons
• Depositing Lab: Ryan Mehl
• Publication: Bednar et al ACS Chem Biol. 2021 Nov 19;16(11):2612-2622. doi: 10.1021/acschembio.1c00649. Epub 2021 Sep 30.

Backbone

• Vector backbone: pUltraI
• Backbone size w/o insert (bp): 3965
• Total vector size (bp): 5297
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Mb Tet3.0RS (R2-3)
• Alt name: Tet3.0RS
• Species: Methanosarcina barkeri (engineered)
• Insert Size (bp): 1260
• Mutation: L170G, N311G, C313A
• Promoter: TacI

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCTCTCCCTTATGCGACTCCTG
• 3′ sequencing primer: CTTCTGCGTTCTGATTTAATCTG

Gene/Insert 2

• Gene/Insert name: Mm tRNA[TAA]
• Alt name: tRNA[TTA]
• Species: Methanosarcina mazei
• Insert Size (bp): 72
• Promoter: ProK

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCGGCCTGCTGACTTTCTCG
• 3′ sequencing primer: CAAATTCGACCCTGAGCTGCTCGAGCATGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Machinery plasmid for incorporation of Tet3.0 at TAA codons.

Please visit https://doi.org/10.1101/2021.04.12.439361 for bioRxiv preprint.