10xHis-TEV-ATG5_ATG7_ATG10_ATG12_ATG16L1-TEV-mGFP-StrepII (Human
autophagy E3(mGFP)-like enzyme)
(Plasmid
#169077)
-
PurposeInsect codon optimized ATG genes (excluded tags): 10xHis-TEV-ATG5, ATG7, ATG10, ATG12 and ATG16L1-GFP-TEV-StrepII
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169077 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGBdest
-
Backbone manufacturerVienna Biocenter Core Facilities GmbH, Vienna, Austria (Protech)
- Backbone size w/o insert (bp) 4958
- Total vector size (bp) 12834
-
Vector typeBacterial Expression, Insect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin and Gentamicin, 50 & 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameATG5
-
Alt nameASP; APG5; APG5L; hAPG5; SCAR25; APG5-LIKE
-
SpeciesH. sapiens (human)
-
Insert Size (bp)894
-
GenBank ID9474 NC_000006.12
- Promoter Polyhedrin promoter
-
Tag
/ Fusion Protein
- HIS10 Tag, TEV cleavage site (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer GGCGGTGAAAACCTGTATTTC
- 3′ sequencing primer TTAGTCCGTAGGTTGGGGAAT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameATG7
-
Alt nameGSA7; APG7L; APG7-LIKE
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2112
-
GenBank ID10533 NC_000003.12
- Promoter Polyhedrin promoter
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer ATGGCAGCGGCTACTGGTGAC
- 3′ sequencing primer AGCGACGATGAGACTATTTAA (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameATG10
-
Alt nameAPG10; APG10L; pp12616
-
SpeciesH. sapiens (human)
-
Insert Size (bp)663
-
GenBank ID83734 NC_000005.10
-
Entrez GeneATG10 (a.k.a. APG10, APG10L, pp12616)
- Promoter Polyhedrin promoter
Cloning Information for Gene/Insert 3
- Cloning method Gateway Cloning
- 5′ sequencing primer ATGGAGGAGGACGAGTTCATC
- 3′ sequencing primer TTAGGGCACGTTTCTTTCGTC (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameATG12
-
Alt nameAPG12; FBR93; APG12L; HAPG12
-
SpeciesH. sapiens (human)
-
Insert Size (bp)423
-
GenBank ID9140 NC_000005.10
- Promoter Polyhedrin promoter
Cloning Information for Gene/Insert 4
- Cloning method Gateway Cloning
- 5′ sequencing primer ATGGCCGAAGAGCCCCAGAGC
- 3′ sequencing primer TTAGCCCCACGCTTGTGATTT (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert nameATG16
-
Alt nameIBD10; WDR30; APG16L; ATG16A; ATG16L
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1881
-
GenBank ID55054 NC_000002.12
-
Entrez GeneATG16L1 (a.k.a. APG16L, ATG16A, ATG16L, IBD10, WDR30)
- Promoter Polyhedrin promoter
-
Tag
/ Fusion Protein
- GFP tag, GGlinker, TEV cleavage site. StrepII (C terminal on insert)
Cloning Information for Gene/Insert 5
- Cloning method Gateway Cloning
- 5′ sequencing primer ATGAGCAGCGGTTTGAGGGCG
- 3′ sequencing primer GCGGTGCTCTGGGCTCAATAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byVienna Biocenter Core Facilities GmbH, Vienna, Austria (Protech)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Internal construct reference: SMC-1100
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
10xHis-TEV-ATG5_ATG7_ATG10_ATG12_ATG16L1-TEV-mGFP-StrepII (Human autophagy E3(mGFP)-like enzyme) was a gift from Sascha Martens (Addgene plasmid # 169077 ; http://n2t.net/addgene:169077 ; RRID:Addgene_169077) -
For your References section:
A PI3K-WIPI2 positive feedback loop allosterically activates LC3 lipidation in autophagy. Fracchiolla D, Chang C, Hurley JH, Martens S. J Cell Biol. 2020 Jul 6;219(7). pii: 151802. doi: 10.1083/jcb.201912098. 10.1083/jcb.201912098 PubMed 32437499