6xHis-TEV-ATG3 (Human autophagy E2-like enzyme)
(Plasmid
#169079)
-
PurposeHuman ATG3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169079 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepETDuet1
-
Backbone manufacturerMerck
- Backbone size w/o insert (bp) 5420
- Total vector size (bp) 6352
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameATG3
-
Alt nameAPG3; APG3L; PC3-96; APG3-LIKE
-
SpeciesH. sapiens (human)
-
Insert Size (bp)945
-
GenBank ID64422 NC_000003.12
- Promoter T7 lac promoter
-
Tag
/ Fusion Protein
- 6X Histidine Tag, TEV cleavage site (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site Notl (not destroyed)
- 5′ sequencing primer ATGCGTCCGGCGTAGA
- 3′ sequencing primer GATTATGCGGCCGTGTACAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Internal construct reference: SMC-861
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
6xHis-TEV-ATG3 (Human autophagy E2-like enzyme) was a gift from Sascha Martens (Addgene plasmid # 169079 ; http://n2t.net/addgene:169079 ; RRID:Addgene_169079) -
For your References section:
A PI3K-WIPI2 positive feedback loop allosterically activates LC3 lipidation in autophagy. Fracchiolla D, Chang C, Hurley JH, Martens S. J Cell Biol. 2020 Jul 6;219(7). pii: 151802. doi: 10.1083/jcb.201912098. 10.1083/jcb.201912098 PubMed 32437499