pTRE-SOX17-P2A-Venus-rpEF1a-Zeo
(Plasmid #169174)

• Purpose: piggyBac transposon to generate a Tet inducible SOX17 expressing cell line. Tet-On inducible when paired with #169175
• Depositing Lab: Igor Slukvin
• Publication: Jung et al Cell Rep. 2021 Feb 16;34(7):108758. doi: 10.1016/j.celrep.2021.108758.

Backbone

• Vector backbone: SPB-007
• Backbone manufacturer: Transposagen Bio
• Total vector size (bp): 9283
• Modifications to backbone: SOX17 downstream of TREtight promoter, along with Zeocin resistance gene driven by the EF1α promoter, are subcloned between ends of two ITRs of the transposon vector. SOX17 is linked with Venus through a P2A, with GSG linker, self-cleaving peptide sequence to allow for easy monitoring of transgene expression following addition of doxycycline to cell cultures.
• Vector type: Mammalian Expression ; piggyBac transposon
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SOX17-P2A-Venus
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 2034
• GenBank ID: NM_022454.4
• Entrez Gene: SOX17 (a.k.a. VUR3)
• Promoter: pTREtight (tet-inducible promoter)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TTGTAACCATTATAAGCTGC, TAGAAGGCACAGTCGAGG
• 3′ sequencing primer: AAAAAGCCATACCAATGGGCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For use in Tet inducible expression systems:
The use of two different antibiotic-resistance genes allows for the selection of clones that incorporate the two vectors in a single step. Although all transgene sequences for conditional gene expression could be potentially cloned into a single plasmid, a two plasmid system provides more flexibility and permits the adjustment of the TRE/M2rtTA ratio to optimize hPSC generation with robust DOX-dependent gene expression, while avoiding transgene leakage.