pEF1α-M2rtTA-T2A-Puro
(Plasmid
#169175)
-
PurposepiggyBac co-transfection transposon containing M2rtTA promoter linked with Puromycin resistance gene, through T2A with GSG linker, subcloned between ends of two ITRs. Pairs with #169174
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169175 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneSPB-007
-
Backbone manufacturerTransposagen Bio
- Total vector size (bp) 7741
-
Modifications to backboneM2rtTA promoter linked with Puromycin resistance gene, through T2A, with GSG linker, peptide sequence, is subcloned between ends of the two ITRs
-
Vector typeMammalian Expression ; piggyBac transposon
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameM2rtTA-T2A-Puro
-
Insert Size (bp)1419
-
MutationSee Depositor Comments Below
- Promoter EF1a
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCCTTTTTGAGTTTGGATCTTGG, ACCTTCTCTAGGCACCGGTT
- 3′ sequencing primer AAAAAGCCATACCAATGGGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For use in Tet-On inducible expression systems:
The use of two different antibiotic-resistance genes allows for the selection of clones that incorporate the two vectors in a single step. Although all transgene sequences for conditional gene expression could be potentially cloned into a single plasmid, a two plasmid system provides more flexibility and permits the adjustment of the TRE/M2rtTA ratio to optimize hPSC generation with robust DOX-dependent gene expression, while avoiding transgene leakage.
Please note: Plasmid contains an E48K mutation in PuroR. This mutation is not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF1α-M2rtTA-T2A-Puro was a gift from Igor Slukvin (Addgene plasmid # 169175 ; http://n2t.net/addgene:169175 ; RRID:Addgene_169175) -
For your References section:
SOX17 integrates HOXA and arterial programs in hemogenic endothelium to drive definitive lympho-myeloid hematopoiesis. Jung HS, Uenishi G, Park MA, Liu P, Suknuntha K, Raymond M, Choi YJ, Thomson JA, Ong IM, Slukvin II. Cell Rep. 2021 Feb 16;34(7):108758. doi: 10.1016/j.celrep.2021.108758. 10.1016/j.celrep.2021.108758 PubMed 33596423