p-EF1a-CreERT2-3Xflag-T2A-eBFP2
(Plasmid #170186)

• Purpose: This Cre-ERT2 expressing construct can be used to inducibly recombine loxp sites. It can be used with poly-loxP containing plasmids to generate timestamp barcodes useful for linage tracing
• Depositing Lab: Bradley Bernstein
• Publication: Kim et al Cell Rep. 2020 Oct 6;33(1):108222. doi: 10.1016/j.celrep.2020.108222.

Backbone

• Vector backbone: pGIR-EF1aFULL-CreERT2-Cterm3xFlag-T2A-eBFP2
• Backbone manufacturer: Bernstein Lab
• Backbone size w/o insert (bp): 7314
• Total vector size (bp): 10167
• Vector type: Lentiviral
• Selectable markers: eBFP2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Grow on LB agar plates at 30 degrees, shaking at 37 in LB broth
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: CreERT2-T2A-eBFP2
• Species: Synthetic
• Insert Size (bp): 2853
• Promoter: EF1 alpha

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: xbalI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: -
• 3′ sequencing primer: agctgacaggtggtggcaat

Resource Information

• Supplemental Documents:
  • pGIR-EF1aFULL-CreERT2-Cterm3xFlag-T2A-eBFP2 (WPS verified).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry