pRN3P_T3_ABEmax_IVT
(Plasmid #171761)

• Purpose: Plasmid to be used as DNA template for in-vitro RNA transcription of the ABEmax base editor (A to G) by T3 RNA polymerase
• Depositing Lab: Timo Otonkoski
• Publication: Jalil et al Stem Cell Reports. 2021 Nov 16. pii: S2213-6711(21)00552-X. doi: 10.1016/j.stemcr.2021.10.017.

Backbone

• Vector backbone: pRN3P
• Backbone manufacturer: Torres-Padilla et al., 2007
• Backbone size w/o insert (bp): 3228
• Total vector size (bp): 8640
• Modifications to backbone: Between the 5'UTR and the 3'UTR we added the ABEmax (Adenine Base Editor #112095)
• Vector type: Vector for in-vitro transcription

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Incubate solid or liquid cultures always at 30°C
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ABEmax
• Alt name: Adenine Base Editor
• Species: Synthetic
• Insert Size (bp): 5412
• Promoter: T3 promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XmaI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: -
• 3′ sequencing primer: ATCCGCGGCCGCTCACCTACTTAGACTTTCCTCTTCTTCTTGGGC

Resource Information

• Supplemental Documents:
  • pRN3P_T3_ABEmax_IVT.gb
• A portion of this plasmid was derived from a plasmid made by: pCMV_ABEmax was a gift from David Liu (Addgene plasmid #112095; http://n2t.net/addgene:112095 ; RRID:Addgene_112095). The in-vitro transcription backbone was published by Torres-Padilla et al., 2007.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry