Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

pLenti X2 Neo/pTER shEGFP#1 (w21-2)
(Plasmid #17479)

Add to Cart
Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    p156RRL-sinPPT-CMV-GFP-PRE/Nhe I
  • Backbone size w/o insert (bp) 7919
  • Vector type
    Lentiviral, RNAi
  • Selectable markers
    Neomycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Stbl3, 37oC
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    Enhanced green fluorescent protein shRNA #1
  • Alt name
    shGFP #1
  • Insert Size (bp)
    65

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl II (destroyed during cloning)
  • 3′ cloning site Hind III (not destroyed)
  • 5′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

shRNA oligo sequence - CGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTCTTTTT

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti X2 Neo/pTER shEGFP#1 (w21-2) was a gift from Eric Campeau (Addgene plasmid # 17479)
  • For your References section:

    A versatile viral system for expression and depletion of proteins in mammalian cells. Campeau E, Ruhl VE, Rodier F, Smith CL, Rahmberg BL, Fuss JO, Campisi J, Yaswen P, Cooper PK, Kaufman PD.. PLoS One. 2009 Aug 6;4(8):e6529. 10.1371/journal.pone.0006529 PubMed 19657394