1
Plasmid 17479: pLenti X2 Neo/pTER shEGFP#1 (w21-2)
  • Enhanced green fluorescent protein shRNA #1

  • shGFP #1

  • 65

  • p156RRL-sinPPT-CMV-GFP-PRE/Nhe I
    (Search Vector Database)

  • Lentiviral, RNAi

  • 7919

  • Bgl II

  • Yes

  • Hind III

  • No

  • n/a List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • Stbl3, 37oC

  • High Copy

  • Neomycin

  • View sequences (2)
  • View map

  • Eric Campeau

  • MTA

Comments: 

shRNA oligo sequence - CGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTCTTTTT

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A versatile viral system for expression and depletion of proteins in mammalian cells. Campeau et al (PLoS One. 2009 Aug 6;4(8):e6529. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 17479" in your Materials and Methods section.