1
Plasmid 17489: pQCXIN X2/pTER shLUC (w347-1)
  • Firefly Luciferase shRNA

  • shLUC

  • 66

  • pQCXIN
    (Search Vector Database)

  • Clontech

  • Retroviral, RNAi

  • 7821

  • Bgl II

  • Yes

  • Hind III

  • No

  • n/a List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • TOP10F', 37oC

  • High Copy

  • Neomycin

  • View sequences (2)
  • View map

  • Eric Campeau

  • MTA
    Luciferase Limited Use Label License

Comments: 

shRNA oligo sequence - 5'-CCTTACGCTGAGTACTTCGAGTGTGCTGTCCTCGAAGTACTCAGCGTAAGTTT

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A versatile viral system for expression and depletion of proteins in mammalian cells. Campeau et al (PLoS One. 2009 Aug 6;4(8):e6529. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 17489" in your Materials and Methods section.