Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PIG-Myc
(Plasmid #177650)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 177650 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MSCV
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 7657
  • Total vector size (bp) 8966
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin ; GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Myc
  • Alt name
    cMyc
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1320
  • GenBank ID
    NM_001177352.1
  • Entrez Gene
    Myc (a.k.a. Myc2, Niard, Nird, bHLHe39)
  • Tags / Fusion Proteins
    • IRES (C terminal on backbone)
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pBabe 5' CTTTATCCAGCCCTCAC
  • 3′ sequencing primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PIG-Myc was a gift from Trudy Oliver (Addgene plasmid # 177650 ; http://n2t.net/addgene:177650 ; RRID:Addgene_177650)
  • For your References section:

    MYC Drives Progression of Small Cell Lung Cancer to a Variant Neuroendocrine Subtype with Vulnerability to Aurora Kinase Inhibition. Mollaoglu G, Guthrie MR, Bohm S, Bragelmann J, Can I, Ballieu PM, Marx A, George J, Heinen C, Chalishazar MD, Cheng H, Ireland AS, Denning KE, Mukhopadhyay A, Vahrenkamp JM, Berrett KC, Mosbruger TL, Wang J, Kohan JL, Salama ME, Witt BL, Peifer M, Thomas RK, Gertz J, Johnson JE, Gazdar AF, Wechsler-Reya RJ, Sos ML, Oliver TG. Cancer Cell. 2017 Feb 13;31(2):270-285. doi: 10.1016/j.ccell.2016.12.005. Epub 2017 Jan 12. 10.1016/j.ccell.2016.12.005 PubMed 28089889