Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

HT107_pAAV_hSyn-DiO-SomQuasAr6a_EGFP-P2A-somCheRiff_HA
(Plasmid #178826)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 178826 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Total vector size (bp) 7537
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SomQuasAr6a_EGFP-P2A-somCheRiff_HA
  • Promoter hSyn
  • Tag / Fusion Protein
    • EGFP; HA

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer hSyn-F: GAGGAGTCGTGTCGTGCCTG
  • 3′ sequencing primer WPRE-R: CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2021.11.22.469481 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HT107_pAAV_hSyn-DiO-SomQuasAr6a_EGFP-P2A-somCheRiff_HA was a gift from Adam Cohen (Addgene plasmid # 178826 ; http://n2t.net/addgene:178826 ; RRID:Addgene_178826)
  • For your References section:

    Video-based pooled screening yields improved far-red genetically encoded voltage indicators. Tian H, Davis HC, Wong-Campos JD, Park P, Fan LZ, Gmeiner B, Begum S, Werley CA, Borja GB, Upadhyay H, Shah H, Jacques J, Qi Y, Parot V, Deisseroth K, Cohen AE. Nat Methods. 2023 Jul;20(7):1082-1094. doi: 10.1038/s41592-022-01743-5. Epub 2023 Jan 9. 10.1038/s41592-022-01743-5 PubMed 36624211