Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGP-CAG-VARNAM A122D WPRE-bGH-polyA
(Plasmid #180486)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 180486 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    unknown
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VARNAM A122D
  • Alt name
    VARNAM insert
  • Alt name
    variant 558.2
  • Species
    Synthetic
  • Insert Size (bp)
    1467
  • Mutation
    A122D
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
  • 3′ sequencing primer TTAAAGCAGCGTATCCACAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2021.11.09.467909 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGP-CAG-VARNAM A122D WPRE-bGH-polyA was a gift from GENIE Project (Addgene plasmid # 180486 ; http://n2t.net/addgene:180486 ; RRID:Addgene_180486)
  • For your References section:

    Sensitivity optimization of a rhodopsin-based fluorescent voltage indicator. Abdelfattah AS, Zheng J, Singh A, Huang YC, Reep D, Tsegaye G, Tsang A, Arthur BJ, Rehorova M, Olson CVL, Shuai Y, Zhang L, Fu TM, Milkie DE, Moya MV, Weber TD, Lemire AL, Baker CA, Falco N, Zheng Q, Grimm JB, Yip MC, Walpita D, Chase M, Campagnola L, Murphy GJ, Wong AM, Forest CR, Mertz J, Economo MN, Turner GC, Koyama M, Lin BJ, Betzig E, Novak O, Lavis LD, Svoboda K, Korff W, Chen TW, Schreiter ER, Hasseman JP, Kolb I. Neuron. 2023 Mar 28:S0896-6273(23)00205-2. doi: 10.1016/j.neuron.2023.03.009. 10.1016/j.neuron.2023.03.009 PubMed 37015225