pTU387
(Plasmid #178981)

• Purpose: pACYC Duet-1 containing full Type III-E system Candidatus “Scalindua brodae” CRISPR array
• Depositing Lab: Stan Brouns
• Publication: van Beljouw et al Science. 2021 Sep 17;373(6561):1349-1353. doi: 10.1126/science.abk2718. Epub 2021 Aug 26.

Backbone

• Vector backbone: pACYC Duet1
• Backbone size w/o insert (bp): 3994
• Total vector size (bp): 5367
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: CRISPR array from Candidatus Scalindua brodae
• Species: Candidatus Scalindua brodae
• Insert Size (bp): 1371
• Promoter: T7

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTATTGTACACGGCCGCATAATC
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: Plasmid contains a single A nucleotide deletion in the CRISPR array from Candidatus Scalindua brodae. This deletion is in a non-coding region and does not affect plasmid function.