pTU422
(Plasmid
#178982)
-
Purpose13S-S Candidatus “Scalindua brodae” Twin- Strep SUMO tagged RAMP (codon-optimization) enriched with CRISPR array spacer 1 (five times)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 178982 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep13S-S
- Backbone size w/o insert (bp) 4021
- Total vector size (bp) 9977
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namegRAMP
-
SpeciesCandidatus Scalindua brodae
-
Insert Size (bp)5169
- Promoter T7
-
Tag
/ Fusion Protein
- Strep-Tag II SUMO (N terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCRISPR array
-
SpeciesCandidatus Scalindua brodae
-
Insert Size (bp)787
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GAACGTGATGGTAAAATGG
- 3′ sequencing primer ACAATTCGTTCAAGCCGAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTU422 was a gift from Stan Brouns (Addgene plasmid # 178982 ; http://n2t.net/addgene:178982 ; RRID:Addgene_178982) -
For your References section:
The gRAMP CRISPR-Cas effector is an RNA endonuclease complexed with a caspase-like peptidase. van Beljouw SPB, Haagsma AC, Rodriguez-Molina A, van den Berg DF, Vink JNA, Brouns SJJ. Science. 2021 Sep 17;373(6561):1349-1353. doi: 10.1126/science.abk2718. Epub 2021 Aug 26. 10.1126/science.abk2718 PubMed 34446442