pAAV-iCre-2A-venus
(Plasmid #182499)

• Purpose: Expresses iCre-venus. The promoter is a fragment of the hdc gene promoter that gives pan neuronal expression
• Depositing Lab: William Wisden
• Publication: Miracca et al J Neurosci. 2022 May 31. pii: JNEUROSCI.0350-21.2022. doi: 10.1523/JNEUROSCI.0350-21.2022.

Backbone

• Vector backbone: pUC
• Backbone size w/o insert (bp): 310
• Total vector size (bp): 7459
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: iCre-2A-Venus
• Species: M. musculus (mouse), Synthetic
• Insert Size (bp): 4404
• GenBank ID: 15186
• Promoter: fragment of histidine decarboxylase gene promoter that gives pan-neuronal expression

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Kpn1 (not destroyed)
• 3′ cloning site: Sal1 (not destroyed)
• 5′ sequencing primer: CATCCACTAAAGGGACTTCCAG
• 3′ sequencing primer: GTCAGCAGGTTGGAGACTTTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note there is a G6E in the insert. Depositor confirms this mutation does not affect plasmid function.